View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_high_9 (Length: 250)
Name: NF1256_high_9
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 33363197 - 33363404
Alignment:
| Q |
11 |
caaaggttatggatatcgatgcaaatataaatatttcaaaaggaacaatcaaagtatttgattatatgc--atataataacatcgaaatcggctaaaatc |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33363197 |
caaagggtatggatatcgatgcaaatataaatttttcaaaaggaacaatcaaagtatttgattatatgcatatataataacatcgaaatcggctaaaatc |
33363296 |
T |
|
| Q |
109 |
ttatttacaaaactttggaatattttgttatttcttgnnnnnnngaatttaagaagctggacaaatgcaaagtgtttgttgctgatcatttagaaattca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33363297 |
ttatttacaaaactttggaatattttgttatttcttgttcttttgaatttaagaagctggacaaatgcaaagtgtttgttgctgatcatttagaaattca |
33363396 |
T |
|
| Q |
209 |
tataatga |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
33363397 |
tataatga |
33363404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University