View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_17 (Length: 275)
Name: NF1256_low_17
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 104 - 244
Target Start/End: Complemental strand, 49769456 - 49769316
Alignment:
| Q |
104 |
tcatgagggtgttttttaggggaaaaaattcacaagggttttgcttttgctaagcttgtctctttctctgttttttaatacactactaacaagtcaggct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49769456 |
tcatgagggtgttttttaggggaaaaaattcataagggttttgcttttgctaagcttgtctctttctctgttttttaatacactactaacaagtcaggct |
49769357 |
T |
 |
| Q |
204 |
tccacgtgctcctggaaagtctcccacacccacttccctat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49769356 |
tccacgtgctcctggaaagtctcccacacccacttccctat |
49769316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University