View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_18 (Length: 265)
Name: NF1256_low_18
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 222
Target Start/End: Complemental strand, 42003350 - 42003149
Alignment:
| Q |
21 |
gtagcatagggaggatcagacatcatagccacaatcgaataattcatgttcttatcgttgttgatactactaatagagcttaaattcaaacaacttatag |
120 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003350 |
gtagcaaaaggaggatcagacatcatagccacaatcgaataattcatgttcttatcgttgttgatactactaatagagcttaaattcaaacaacttatag |
42003251 |
T |
|
| Q |
121 |
gtggtactaaatttattacggttgaattggaaggacaatttaggaatgaaaaattaacaaaagtgtaataatcacttaaccgaaacggtgaatctttaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003250 |
gtggtactaaatttattacggttgaattggaaggacaatttaggaatgaaaaattaacaaaagtgtaataatcacttaaccgaaacggtgaatctttaag |
42003151 |
T |
|
| Q |
221 |
gt |
222 |
Q |
| |
|
|| |
|
|
| T |
42003150 |
gt |
42003149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University