View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_21 (Length: 253)
Name: NF1256_low_21
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 42274306 - 42274466
Alignment:
| Q |
1 |
gtggtttccttcagtaaccatccatggtcttttactagcatatggttctactaaacgaccaaaagaatcccataatggttgttgtgagtctgcatatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42274306 |
gtggtttccttcagtaaccatccatggtcttttactagcatatggttctactaaacgaccaaaagaatcccataatggttgttgtgagtctgcatatgat |
42274405 |
T |
 |
| Q |
101 |
agatctcctggtatcaagaatacatcgtagacgcttttgtcgacatgttttagggttgatg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42274406 |
agatctcctggtatcaagaatacatcgtagtcgcttttgtcgacatgttttagggttgatg |
42274466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University