View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_24 (Length: 251)
Name: NF1256_low_24
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 33363546 - 33363748
Alignment:
| Q |
21 |
tatagaagtatatatattgtaaattgaaatcttttggctagctagaacataaaaagacatcgatatacttagtttt-tactcttgttttgaagaaaatat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
33363546 |
tatagaagtatatatattgtaaattgaaatcttttggctagctagaacataaaaagacatcgatatacttagatctatactcttgttttgaagaaaatat |
33363645 |
T |
 |
| Q |
120 |
atgcatataccttttgaaggataggaaaaactaaaatttacctggatgtatatgaaggagaaaaaagggtagttttcctttggcttcttgatgatacaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33363646 |
atgcatataccttttgaaggataggaaaaactaaaatttacctggatgtatatgaaggagaaaaaagggtagttttcctttggcttcttgatgatacaat |
33363745 |
T |
 |
| Q |
220 |
aca |
222 |
Q |
| |
|
||| |
|
|
| T |
33363746 |
aca |
33363748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University