View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_26 (Length: 239)
Name: NF1256_low_26
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 88 - 239
Target Start/End: Complemental strand, 15264949 - 15264798
Alignment:
| Q |
88 |
aggggttcagataggaagaaacaggtccatagtgttggcactgtctaataaatgcgaatgacattgagaattaaacataatgtatcaatgtgtatgagta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15264949 |
aggggttcagataggaagaaacaggtccatagtgttggcactgtctaataaatgcgaatgacattgagaattaaacataatgtagcaatgtgtatgagta |
15264850 |
T |
 |
| Q |
188 |
gttttactcagtagcaacttgaaccaattgctataaatgcacctctgttgtt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15264849 |
gttttactcagtagcaacttgaaccaattgctataaatgcacctctgttgtt |
15264798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University