View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1256_low_28 (Length: 204)

Name: NF1256_low_28
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1256_low_28
NF1256_low_28
[»] chr8 (1 HSPs)
chr8 (98-181)||(39793435-39793518)


Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 98 - 181
Target Start/End: Original strand, 39793435 - 39793518
Alignment:
98 ccctgcaacaggtttgtttctacttcccnnnnnnnggggactgagcacaacaaaagataccatcatacgaagtggtaggttgcc 181  Q
    ||||||||||||||||||||||||| ||        ||||||||||||||| ||||||||||||||||||||||||||||||||    
39793435 ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgcc 39793518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University