View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_29 (Length: 203)
Name: NF1256_low_29
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 31867815 - 31867762
Alignment:
| Q |
121 |
cgaggtatataatttgcttagatttcatagcgaagagctcgcaaaattgcattc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31867815 |
cgaggtatataatttgcttagatttcatagcgaagagctcgcaaaattgcattc |
31867762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University