View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_4 (Length: 528)
Name: NF1256_low_4
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 128 - 507
Target Start/End: Original strand, 31607364 - 31607743
Alignment:
| Q |
128 |
gatgggagctttgtccggctcaattccatggtacacgatgatggtgttgcacaaaagatcgtcattctttcaaagtgtagatgatacattaggagtcttt |
227 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607364 |
gatgggagctttgtccggttcaattccatggtacacgatgatggtgttgcacaaaaaatcaccattctttcaaagtgtagatgatacattaggagtcttt |
31607463 |
T |
 |
| Q |
228 |
cacactcatgctgtggctggtattcttgggggaatcctttctggtgtgtttgccaaacctaaacttttgaggattctctatggtccttatgggtctggct |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607464 |
cacactcatgctgtggctggtattcttgggggaatcctttctggtgtgtttgccaaacctaaacttttgaggattctctatggtccttatgggtctggct |
31607563 |
T |
 |
| Q |
328 |
tattgtatagttattttgatgataatataggtcaaggaatcaagcaaatgtggtaccaattattaggagcagtttttattactatttggaatgttgttat |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607564 |
tattgtatagttattttgatgataatataggtcaaggaatcaagcaaatgtggtaccaattattaggagcagtttttattactatttggaatgttgttat |
31607663 |
T |
 |
| Q |
428 |
tactagtctgatttgtattcttttaaatcgctttgtgaatcttcgaatgcaagaagaagagcttgaggttggtgatgatg |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31607664 |
tactagtctgatttgtattcttttaaatcgctttgtgaatcttcgaatgcaagaagaagaccttgaggttggtgatgatg |
31607743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University