View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1256_low_8 (Length: 409)
Name: NF1256_low_8
Description: NF1256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1256_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 9e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 183 - 349
Target Start/End: Original strand, 3909359 - 3909525
Alignment:
| Q |
183 |
atctgcttctttggctctaaatcaatggcatgatctgtcagagttcaatcctcctcagtgatcttattcatgttgttgctgcacctagaaaatccaaaga |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909359 |
atctgcttctttggctctaaatcaatggcatgatctgtcagagttcaatcctcctcagtgatcttattcatgttgttgctgcacctagaaaatccaaaga |
3909458 |
T |
 |
| Q |
283 |
tagaaagcatagctctgagaaattaatctatcttgtttcgnnnnnnngaataaaaggtctaagtaga |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3909459 |
tagaaagcatagctctgagaaattaatctatcttgtttcgtttttttgaataaaaggtctaagtaga |
3909525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University