View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1257-Insertion-2 (Length: 218)
Name: NF1257-Insertion-2
Description: NF1257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1257-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 6 - 218
Target Start/End: Complemental strand, 50111538 - 50111326
Alignment:
| Q |
6 |
caatttgtgggtctttgtcagtaaccaaatatgcctacctagataatacatttgtaattgtatctgtataaaaatatctaatccattgtttcatgaagga |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50111538 |
caatttgtgggtcattgtcagtaaccaaatatgcctacgtagatgatacatttgtaattgtatctgtataaaaatatctaatccattgtttcatgaagga |
50111439 |
T |
|
| Q |
106 |
gaaagaagagaaaaatctttatgtttgaatgaatccatggtcttatacatcaaaagagaccatgcatcggaacaaatgcaaaatattttgtttgtaccta |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50111438 |
taaaggagagaaaaatctttatgtttgaatgaatccatggtcttatacatcaaaagagaccatgcatcggaacaaatgcaaaatattttgtttgtaccta |
50111339 |
T |
|
| Q |
206 |
cacataacttaag |
218 |
Q |
| |
|
||||||||||||| |
|
|
| T |
50111338 |
cacataacttaag |
50111326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University