View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1257-Insertion-3 (Length: 174)
Name: NF1257-Insertion-3
Description: NF1257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1257-Insertion-3 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 24518177 - 24518344
Alignment:
| Q |
7 |
agtttttagtaccattttgcgggctcaaaatgttattgttttccctcattccttgattttagtaggtgaaattttctctatatgggagtttccatttttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24518177 |
agtttttagtaccattttgcgggctcaaaatgttattgttttctctcattccttgattttagtaggtgaaattttctctatatgggagtttccatttttt |
24518276 |
T |
 |
| Q |
107 |
cttccaattgatttgtggaagaatcttggttcttgtgaggggattgtgtgggactattttaagtctta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
24518277 |
cttccaattgatttgtggaagaatcttggttcttgtgagaggattgtgtgggactaatttaagtctta |
24518344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 9e-44
Query Start/End: Original strand, 7 - 139
Target Start/End: Original strand, 24507182 - 24507314
Alignment:
| Q |
7 |
agtttttagtaccattttgcgggctcaaaatgttattgttttccctcattccttgattttagtaggtgaaattttctctatatgggagtttcca-ttttt |
105 |
Q |
| |
|
|||||||| ||| |||||||| |||||||||||||| |||||| ||||||||||||||||||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
24507182 |
agtttttaatactattttgcgtgctcaaaatgttat-gttttctctcattccttgattttagttgatgaaattttctctatatgggagtttccatttttt |
24507280 |
T |
 |
| Q |
106 |
tcttccaattgatttgtggaagaatcttggttct |
139 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
24507281 |
ttttccaattgatttgtggaagaatcttggttct |
24507314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 24507421 - 24507459
Alignment:
| Q |
136 |
ttcttgtgaggggattgtgtgggactattttaagtctta |
174 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
24507421 |
ttcttgtgaggggattgtgtaggactattttaactctta |
24507459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University