View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1257-Insertion-5 (Length: 162)
Name: NF1257-Insertion-5
Description: NF1257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1257-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 11 - 158
Target Start/End: Complemental strand, 43580045 - 43579898
Alignment:
| Q |
11 |
gtgactctgacaatttcactgtcaatccaaatatgcactaataccgatagtaaggtggtgcatataaagcataaccatgttgatgaggggcgtacatggg |
110 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580045 |
gtgactctaacaatctcactatcaatccaaatatgcactaatactgatagtaaggtggtgcatataaagcataaccatgttgatgaggggcgtacatggg |
43579946 |
T |
|
| Q |
111 |
atcataactattgtaccgataatagggcatcggtgggggaggaggagg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43579945 |
atcataactattgtaccgataatagggcatcggtggaggaggaggagg |
43579898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 93 - 162
Target Start/End: Original strand, 43677895 - 43677964
Alignment:
| Q |
93 |
atgaggggcgtacatgggatcataactattgtaccgataatagggcatcggtgggggaggaggaggagga |
162 |
Q |
| |
|
||||||||| ||||| ||||| ||| |||||||| ||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
43677895 |
atgaggggcatacataggatcgtaattattgtactgataataaggcattggtggaggaggaggaggagga |
43677964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University