View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12571_low_15 (Length: 230)
Name: NF12571_low_15
Description: NF12571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12571_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 17538373 - 17538149
Alignment:
| Q |
1 |
ttctttgatttgaattgtctgtttgtctggtctgctcagagattggattggagtatgtcactttcttaatttttgttac-ttggaatgcaaattatgtta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17538373 |
ttctttgatttgaattgtctgtttgtctggtctgctgagagattggattggagtatgtcactttcttaatttttgttactttggaatgcaaattatgtta |
17538274 |
T |
|
| Q |
100 |
gtgaag----ttactttattttcccttctannnnnnnatgatacttgaaggcagaannnnnnnnnattgcttattagtttcttccaatttactttcaaaa |
195 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17538273 |
gtgaagttaattactttattttcccttctatttttttctgatacttgaaggcagaaaaactttttattgcttattagtttcttccaatttactttcaaaa |
17538174 |
T |
|
| Q |
196 |
gcttcaaatcattttattttctctg |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
17538173 |
gcttcaaatcattttattttctctg |
17538149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 59 - 125
Target Start/End: Original strand, 17694259 - 17694325
Alignment:
| Q |
59 |
cactttcttaatttttgttacttggaatgcaaattatgttagtgaagttactttattttcccttcta |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17694259 |
cactttcttaatttttgttttttggaatgcaaattatgttagtgaagttactttattttcccttcta |
17694325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University