View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12573_high_9 (Length: 239)
Name: NF12573_high_9
Description: NF12573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12573_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 365289 - 365486
Alignment:
| Q |
24 |
ctttttatgttaatggatgagtgtgaattacctaattttaacttttaacaaaacttaagtcaagaaagccgactctccttctttcannnnnnnnnnncct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
365289 |
ctttttatgttaatggatgagtgtgaattacctaattttaacttttaacaaaacttaagtcaagaaagccgactctccttctttcattttttttt--cct |
365386 |
T |
 |
| Q |
124 |
ttctaataagcaaaatgaaaattgatggagtagaagaaatacttcaaaatcaaaatccgatacaaggagaactaaccactttgcaatgaaaaggtcattg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365387 |
ttctaataagcaaaatgaaaattgatggagtagaagaaatacttcaaaatcaaaatccgatacaaggagaactaaccactttgcaatgaaaaggtcattg |
365486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University