View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12573_low_10 (Length: 280)

Name: NF12573_low_10
Description: NF12573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12573_low_10
NF12573_low_10
[»] chr1 (1 HSPs)
chr1 (1-227)||(23876567-23876793)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 23876793 - 23876567
Alignment:
1 atgttcagtaacctatgaaacacaataaaagaagcatagccgcatattttgatacaaaataagagagtttgagaaatttatca-ggcatataaattttga 99  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||    
23876793 atgttcagtaatctatgaaacacaataaaagaagcatagccgcatattttgatacaaaataagagaatttgagaaatttatcaaggcatataaattt-ga 23876695  T
100 ccatcatacaaataaaaacatattagcaatagacaaatgaagcaccgccaaccaaatatcataactctaaaacaagacttggattgcaaaatcataccaa 199  Q
    |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23876694 ccatcatacaaataaaaacagattagcagtagacaaatgaagcaccgccaaccaaatatcataactctaaaacaagacttggattgcaaaatcataccaa 23876595  T
200 agaatatgtcgtgttaatgaaaacatac 227  Q
    | ||||| ||||||||||||||||||||    
23876594 ataatatatcgtgttaatgaaaacatac 23876567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University