View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12573_low_13 (Length: 246)
Name: NF12573_low_13
Description: NF12573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12573_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 29007098 - 29007308
Alignment:
| Q |
16 |
atgaagcacagacacaaacacatgcatcaggatattgacaatg-tacaattcactgatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgatt |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007098 |
atgaagcacggacacaaacacatgcatcaggatattgaaaatgatacaattca--gatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgatt |
29007195 |
T |
|
| Q |
115 |
gcaca--acacaagaaaacgtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattacatttgcatttgaattgta |
212 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29007196 |
gcacagcacacaaaaaaatgtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattgcatttgcatttgaattgta |
29007295 |
T |
|
| Q |
213 |
cagggttgatgtt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29007296 |
cagggttgatgtt |
29007308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University