View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12573_low_9 (Length: 299)
Name: NF12573_low_9
Description: NF12573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12573_low_9 |
 |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 10898240 - 10898045
Alignment:
| Q |
19 |
aaaccggggcattataatcttatgaactcgcataagcacttatgaaactgtttgtaagagcttacataatcaatttatgatatattatgtattgataagt |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10898240 |
aaactggggcattataatcttatgaactcgcataagcacttatgaaactgtttgtaagagcttacataagcaatttatgatatattatgtattgataagt |
10898141 |
T |
 |
| Q |
119 |
tgtttttagcttatttccataaacactt-aaagtgaaatgcaaaatagattgatacctttgatgatcggaataaggaatagaccttagaaggttaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10898140 |
tgtttttagcttatttccataaacacttaaaagtgaaatgcaaaatagattgatacctttggtgatcggaataaggaatagaccttagaaggttaa |
10898045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 142
Target Start/End: Original strand, 55547054 - 55547083
Alignment:
| Q |
113 |
ataagttgtttttagcttatttccataaac |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55547054 |
ataagttgtttttagcttatttccataaac |
55547083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 145
Target Start/End: Original strand, 10627 - 10659
Alignment:
| Q |
113 |
ataagttgtttttagcttatttccataaacact |
145 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
10627 |
ataagttgttttcagcttatttccataaacact |
10659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University