View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12574_low_7 (Length: 218)
Name: NF12574_low_7
Description: NF12574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12574_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 36 - 209
Target Start/End: Complemental strand, 14728167 - 14727994
Alignment:
| Q |
36 |
tttccttggtgtttcacatcttctctcaaagtatgttctatatcagattttcttggaattaaacctgatatcgaagctgtaaagtttttgttagaaaatg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14728167 |
tttccttggtgtttcacatcttctctcaaagtatgttctatatcagattttcttggaattaaacctgatatcgaagctgtaaagtttctgttagaaaatg |
14728068 |
T |
|
| Q |
136 |
ccacagtcttaggggagatcaacatattctgttcggaattattatcaaaaaatttggaggagcttgctgatgtc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14728067 |
ccacagtcttaggggagatcaacatattctgttcggaattattatcaaaaaatttggaggagcttgcttatgtc |
14727994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 36 - 209
Target Start/End: Original strand, 17595318 - 17595491
Alignment:
| Q |
36 |
tttccttggtgtttcacatcttctctcaaagtatgttctatatcagattttcttggaattaaacctgatatcgaagctgtaaagtttttgttagaaaatg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595318 |
tttccttggtgtttcacatcttctctcaaagtatgttctatttcagattttcttggaattgaacctgatatcgaagctgtaaagtttttgttagaaaatg |
17595417 |
T |
|
| Q |
136 |
ccacagtcttaggggagatcaacatattctgttcggaattattatcaaaaaatttggaggagcttgctgatgtc |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17595418 |
ccacagtcttaggggagatcaacatatcctgttcggagttattatcaaaaaatttggagaagcttgctgatgtc |
17595491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 698546 - 698585
Alignment:
| Q |
1 |
actgccatgggttaactgatgttgcgtatatatcttttcc |
40 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
698546 |
actgccatgggttaactgatgttgtgtatatatcttttcc |
698585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University