View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12575_low_12 (Length: 259)
Name: NF12575_low_12
Description: NF12575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12575_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 243
Target Start/End: Original strand, 47624912 - 47625144
Alignment:
| Q |
11 |
cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624912 |
cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc |
47625011 |
T |
 |
| Q |
111 |
ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaacttgaataatttgcacagacatataaacactaaacaacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625012 |
ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaacttgaataatttgcacagacatataaacactaaacaacaa |
47625111 |
T |
 |
| Q |
211 |
taatctagcagcttaaacagctatagtaaaatc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47625112 |
taatctagcagcttaaacagctatagtaaaatc |
47625144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University