View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12575_low_14 (Length: 248)
Name: NF12575_low_14
Description: NF12575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12575_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 18031577 - 18031817
Alignment:
| Q |
1 |
ctctggcatgagatttctccatccactgttaatttgacatcgccgaagaatctcttgtacttccatacagtacttgggttcatagtctttgtggcattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18031577 |
ctctggcatgagatttctccatccactgttaatttgacatcgccgaagaatctcttgtacttccatacagtacttgggttcatagtctttgtggcattgc |
18031676 |
T |
 |
| Q |
101 |
agttctgaaatgtaatgttcaccaggttcatctttaacaagttcatcaatctttgccaagagatgtccgaaatcacgctcaaatttagttcgtcgaagat |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18031677 |
agttgtgaaatgtaatgttcaccaggttcatctttaacaagttcatcaatctttgccaagagatgtccgaaatcacgctcaaatttagttcgtcgaagat |
18031776 |
T |
 |
| Q |
201 |
cctctgttgttttcctacaatacttgtattcagtgtctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18031777 |
cctctgttgttttcctacaatacttgtattcagtgtctgtg |
18031817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 34
Target Start/End: Original strand, 27401526 - 27401555
Alignment:
| Q |
5 |
ggcatgagatttctccatccactgttaatt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27401526 |
ggcatgagatttctccatccactgttaatt |
27401555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University