View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12576_low_3 (Length: 267)
Name: NF12576_low_3
Description: NF12576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12576_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 37 - 257
Target Start/End: Original strand, 2484397 - 2484618
Alignment:
| Q |
37 |
gtttctccttcattagtttttctgattgattgtccctctctgttggtctcttcttcatacttttgaatgattgtatctctccctcttggtttcttcttct |
136 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
2484397 |
gtttctccctcattagtttttctcattgattgtccctctctgttggtctcttcttcattcttttgattgattgtatctctccctcttgatttcttcttct |
2484496 |
T |
|
| Q |
137 |
gattgattggattgcttctccctgttttgattcttctaattgattgcttctctccctttttaattccttctaattgatttcttct-cctctgttgattgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| ||||||| | |
|
|
| T |
2484497 |
gattgattggattgcttctccctgttttgattcttctaattgattgtttctccccctttttaattccttctaattgatttcttctcccttagttgattat |
2484596 |
T |
|
| Q |
236 |
tctgattgatttcttctctctc |
257 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2484597 |
tctgattgatttcttctctctc |
2484618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 11828434 - 11828384
Alignment:
| Q |
146 |
gattgcttctccctgttttgattcttctaattgattgcttctctccctttt |
196 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11828434 |
gattgcttctcccccttttgattcttttaattgattgcttctttccctttt |
11828384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 8574429 - 8574462
Alignment:
| Q |
163 |
ttgattcttctaattgattgcttctctccctttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8574429 |
ttgattcttctaattgattgcttctctccctttt |
8574462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University