View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12577_high_3 (Length: 254)
Name: NF12577_high_3
Description: NF12577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12577_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 41336359 - 41336578
Alignment:
| Q |
20 |
tgtcattgtcattgattaattgtttgtgtttatgtattgtg--agtttatggtgtgttctatatgaactttctttaagttgtataacaatgtgtgcttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41336359 |
tgtcattgtcattgattaattgtttatgtttatgtattgtgtgagtttatggtgtgttctatatgaactttctttaagttgtataacaatgtgtgcttgt |
41336458 |
T |
 |
| Q |
118 |
agtaatcatcaactattatgtgattgctttcagaaatgttatgatatcaatattatttgggtacatcattttctcctatatttacttacacttatgcaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41336459 |
agtaatcatcaactattatgtgattgctttcagaaatgttatgatatcaatattatttgggtacatcattttctcctatatttacttacacttatgcaac |
41336558 |
T |
 |
| Q |
218 |
ggttttggtcacgtacggca |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41336559 |
ggttttggtcacgtacggca |
41336578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University