View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12577_low_8 (Length: 243)
Name: NF12577_low_8
Description: NF12577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12577_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 12546687 - 12546452
Alignment:
| Q |
1 |
tgcagtggtagtatatctttctgatcttgtttatatgtattcaacacataaatgaatagtccatgatgttcctctattaacctcattattgaattctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12546687 |
tgcagtggtagtatatctttctgatcttgtttatatgtattcaacacataaatgaatagtccatgatgttcctctattaacctcattattgaattctctt |
12546588 |
T |
|
| Q |
101 |
attcattctagcatgggtaattagttgtttggaatttaaaaacagttgcagcaatttattttaattgtcaactgtaggaatcatatgcacaaagatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12546587 |
attcattctagcatgggtaattagttgtttggaatttaaaaacagttgcagcaatttattttaattgtcaactgtaggaatcatatgcacaaagatgttt |
12546488 |
T |
|
| Q |
201 |
taacttgattgaagaacatgcgcctggtctctgctc |
236 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12546487 |
taacttgattgaagaacatgcgcctggcttctgctc |
12546452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University