View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12578_high_23 (Length: 254)
Name: NF12578_high_23
Description: NF12578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12578_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 15592083 - 15591877
Alignment:
| Q |
19 |
ccctaaacactttcttatcttttcttgagaacaaatttgaagaacatgacaatggatacagtaagtaattggtattataagatcaattatgcttcgatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15592083 |
ccctaaacactttcttatcttttcttgagaacaaatttgaagaacatgacaatggatacagtaagtaattggtattataagatcaattatgcttcgatca |
15591984 |
T |
 |
| Q |
119 |
gttttgaagttatttccttgttttttgatcatctttcatcccattaacagatggttttaaatgtttaccatgaagatataacattcttatttta-tcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15591983 |
gttttgaagttatttccttgttttttgatcatctttcatcccattaacagatggttttaaatgtttaccatgaagatataacattcttattttattcttt |
15591884 |
T |
 |
| Q |
218 |
ccacaag |
224 |
Q |
| |
|
||||||| |
|
|
| T |
15591883 |
ccacaag |
15591877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University