View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12578_high_9 (Length: 363)
Name: NF12578_high_9
Description: NF12578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12578_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 166 - 290
Target Start/End: Complemental strand, 38750966 - 38750842
Alignment:
| Q |
166 |
gtagggaaaatggcgatgatgatgtaagtgtcaaaattctatattgtggagtttgtcattctgatctacacactctcaagaacgattggggtttcactac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750966 |
gtagggaaaatggcgatgatgatgtaagtgtcaaaattctatattgtggagtttgtcattctgatctacacactctcaagaacgattggggtttcactac |
38750867 |
T |
 |
| Q |
266 |
ttaccctgttgttcctgggtatgta |
290 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38750866 |
ttaccctgttgttcctgggtatgta |
38750842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 38751134 - 38751066
Alignment:
| Q |
1 |
cgaaatcacccgaaaccgaactcccactcaaagcttttgg-ttgggctgctagagacacttctggcacc |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38751134 |
cgaaatcacccgaaaccgaactcccactcaaagcttttggtttgggctgctagagacacttctggcacc |
38751066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University