View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12578_low_22 (Length: 299)
Name: NF12578_low_22
Description: NF12578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12578_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 264
Target Start/End: Complemental strand, 40127298 - 40127041
Alignment:
| Q |
8 |
gagcacagaaggcagtatgatgggacccatgtttcggtagatagataccaggggagagattactgggtggtgaatgtgagaagccaagatcgtcctaagt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40127298 |
gagcacaaaaggcagtatgatgggacccatgtttcggtggatagataccaggggagagattactgggtggtgaatgtgagaagccgagatcgtcctaagt |
40127199 |
T |
|
| Q |
108 |
tactgtttgatattgtgtgcatgctcacggacatgcaatatgaggtgtttcatgcggctgttacctcgaacagcccaatggcagaacaggtacaccggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40127198 |
tactgtttgatattgtgtgcatgctcacggacatgcaatatgaggtgtttcatgcggctgttacctcgaacagccccatggcagaacaggtacaccggat |
40127099 |
T |
|
| Q |
208 |
ttttcaattaattatttgc-aggccaaaaggtatataggtgcaattatttatgtggtg |
264 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127098 |
ttttcaattaattatctgcaaggccaaaaggtatataggtgcaattatttatgtggtg |
40127041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University