View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12578_low_28 (Length: 250)
Name: NF12578_low_28
Description: NF12578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12578_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 29226547 - 29226306
Alignment:
| Q |
1 |
gactttgatgctttgataattaaggatatgatgttgatccttgtacaaataattgatctagtgaataagttttttaggtgaatgctttgaacttgatcg- |
99 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29226547 |
gactttgatgctttaattattaaggatatgatgttgatccttgtacaaataattgatctagtgaataagttttttaggtgaatgctttgaacttgatcat |
29226448 |
T |
 |
| Q |
100 |
atc-atatggaatgatataaacaatactacatattgacttcgtgaacaacaactcggacgaactat---cttaagcaatgaaccagataaaatattttac |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29226447 |
atatatatggaatgatataaacaatactacatattgacttcgtgaacaacaactcggacgaactatgatcttaagcaatgaaccagataaaatattttac |
29226348 |
T |
 |
| Q |
196 |
ttatatatagaagaggatttcccttttcttcgatttcccttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29226347 |
ttatatatagaagaggatttcccttttcttcgatttcccttc |
29226306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University