View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12578_low_31 (Length: 244)
Name: NF12578_low_31
Description: NF12578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12578_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 37803908 - 37803696
Alignment:
| Q |
18 |
ttattaagttaagaagtgtagatattatttataaactatttgtagtctatattgtcagacaatgtgaaattttttggtgtactggaacagtagccttcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
37803908 |
ttattaagttaagaagtgtagatattatttataaactattcgtagtctatattgttagacaatgtaaaattttttggtgtactggaacaatagccttcta |
37803809 |
T |
|
| Q |
118 |
gtcgaggctaaatgatttatcagctctcgagcttggtataggttcaacctcttcatggtgtaccaatgttcagacctcaagtctataatattacatattt |
217 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
37803808 |
gtcgaggctaaatgatctatcagctcttgagtttggtataggttcaacctcttcatggtgtgtcaatgttcggacctcaagtctagaacattacatattt |
37803709 |
T |
|
| Q |
218 |
gaggtattgttca |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37803708 |
gaggtattgttca |
37803696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University