View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12578_low_32 (Length: 230)
Name: NF12578_low_32
Description: NF12578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12578_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 30 - 217
Target Start/End: Original strand, 10103975 - 10104162
Alignment:
| Q |
30 |
cataaattttgttttgaaaagannnnnnnnnacaattattttagaatggatggagtattgtttttaatccatgttaaacatttatacaatcaaaacaaaa |
129 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10103975 |
cataaattttgttttgaaaagatttttttttacaattattttagaatggatggagtattgtttttaatccatgttaaacatttatacaatcaaaagaaaa |
10104074 |
T |
|
| Q |
130 |
attgttcaatatatgaaggttaagttgaagttgatgaggatgtaaattgtaatgcatgcagattctaaaacaaattggaggaggtttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10104075 |
attgttcaatatatgaaggttaagttgaagttgatgaggatgtaaattgtaatgcatgcagattctaaaacaaattggaggaggtttt |
10104162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University