View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12579_high_13 (Length: 378)

Name: NF12579_high_13
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12579_high_13
NF12579_high_13
[»] chr3 (4 HSPs)
chr3 (20-167)||(42169539-42169681)
chr3 (232-322)||(42169324-42169414)
chr3 (191-235)||(42169471-42169515)
chr3 (341-369)||(42169283-42169311)
[»] chr4 (1 HSPs)
chr4 (232-322)||(36075347-36075439)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 3e-61; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 42169681 - 42169539
Alignment:
20 actatgacctctccctcgaccgtgtctaattcctcgacttgattcgattccctcgtattgttggaaaatccaaaactgactcctttacattttcttgtgt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||| |||||||||||||||||||||||||||| |||    
42169681 actatgacctctccctcgaccgtgtctaattcctcgacttgattc-----cctcgtattgttggaaattccaaaactgactcctttacattttcttatgt 42169587  T
120 cgtatgagaacctagcttcttccgttttcttatgccaaagctcttagc 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
42169586 cgtatgagaacctagcttcttccgttttcttatgccaaagctcttagc 42169539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 232 - 322
Target Start/End: Complemental strand, 42169414 - 42169324
Alignment:
232 agctttattggatgatgcatgctttaaacattgggnnnnnnnctttatgcatattttaaatgaattccttttgtttttattgaagcttcaa 322  Q
    ||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||    
42169414 agctttattggatgatgcatgctttaaacattggatttttttctttatgcatattttaaatgaattccttttgtttttattgaagcttcaa 42169324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 42169515 - 42169471
Alignment:
191 gcctttagaatgatcccaagtgtcttatttatagtgttttcagct 235  Q
    ||||||||||||||||||||||||||||||||||| |||||||||    
42169515 gcctttagaatgatcccaagtgtcttatttatagttttttcagct 42169471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 369
Target Start/End: Complemental strand, 42169311 - 42169283
Alignment:
341 atttctccatatatgtagatgtttcatct 369  Q
    |||||||||||||||||||||||||||||    
42169311 atttctccatatatgtagatgtttcatct 42169283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 232 - 322
Target Start/End: Complemental strand, 36075439 - 36075347
Alignment:
232 agctttattggatgatgcatgctttaaacattgggnnnnnnncttt--atgcatattttaaatgaattccttttgtttttattgaagcttcaa 322  Q
    ||||||||||||||||||||||||||||||||||         |||  || |||||||||||||||||| |||||||||||||||||||||||    
36075439 agctttattggatgatgcatgctttaaacattggatttttttttttttatacatattttaaatgaattcgttttgtttttattgaagcttcaa 36075347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University