View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_high_17 (Length: 346)
Name: NF12579_high_17
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 3216830 - 3216553
Alignment:
| Q |
19 |
tgtggaagtacaatcaaaagaaga---tgaaggaagagaaacaagaccagaaaggaaaactaggattttgattattcttatgaaagttgggaagaaattg |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3216830 |
tgtggaagtacaatcaaaagaagaagatgaaggaagagaaacaagaccagaaaggaaaactaggatcttgattattcttatgaaagttgggaagaaattg |
3216731 |
T |
|
| Q |
116 |
atcatgaatcctaatacttatgcaacttttataggccttatttgggcaagcatacacttcaggtaagcacaatgtcacatttgtttagttcattagggtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
3216730 |
atcatgaatcctaatacttatgcaacttttataggccttatttgggcaagcatacacttcaggtaagcccaatgtcacatttgtttagttcactagggtt |
3216631 |
T |
|
| Q |
216 |
ttaaataaaggtccgcgaccacaatatgcgccgcaacataattttgacattgtcaaaacttcaatgtgaccgcgatta |
293 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3216630 |
ttaaataaaggtctgcaaccacaatatgcgccgcaacataattttgacattgtcaaaactgcaatgtgaccgcgatta |
3216553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 290 - 346
Target Start/End: Original strand, 3216533 - 3216589
Alignment:
| Q |
290 |
attatagtcaaatgtggctataatcgcggtcacattgcagttttgacaatgtcaaaa |
346 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3216533 |
attatagtcaaatgtggctgtaatcgcggtcacattgcagttttgacaatgtcaaaa |
3216589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University