View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_high_27 (Length: 255)
Name: NF12579_high_27
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 18 - 163
Target Start/End: Original strand, 40033654 - 40033790
Alignment:
| Q |
18 |
accctgtttattctctcaccatttcattttctctaccggttctagggtttctgagtaacttcattcaaggtaaatttctttcgcacaatttagggtacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40033654 |
accctgtttattctctcaccatttcattttctcta---------gggtttctgagtaacttcattcaaggtaaatttctttctcacaatttagggtacaa |
40033744 |
T |
 |
| Q |
118 |
tttcatttctatttgatgtgttcttatcatttaggatagttagata |
163 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033745 |
tttcgtttctatttgatgtgttcttatcatttaggatagttagata |
40033790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 201 - 241
Target Start/End: Original strand, 40033834 - 40033874
Alignment:
| Q |
201 |
cgtattcgatcatgataataatgtttatgcttaagtttatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033834 |
cgtattcgatcatgataataatgtttatgcttaagtttatg |
40033874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University