View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_high_31 (Length: 241)
Name: NF12579_high_31
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_high_31 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 43138879 - 43139118
Alignment:
| Q |
1 |
tctgattttgctgtctctgattcaatctcattcatattaaaattacattttttaaatgtcaaactctcaaatgatagtttgttgtccatttagatctcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43138879 |
tctgattttgctgtctctgattcaatctcattcatattaaaattacattttttaaatgtcaaactctcaa-tgatagtttgttgtccatttagatctcac |
43138977 |
T |
 |
| Q |
101 |
aaaacttgaggtattagtctttacatgtgcaaatgataccttgttaacaccaaaaaagatcatacatttttcaaatgcctccttgagtcattcaccgctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43138978 |
aaaacttgaggtattagtctttacatgtgcaaatgataccttgttaacaccaaaaaagatcatacatttttcaaatgcctccttgagtcattccccgctg |
43139077 |
T |
 |
| Q |
201 |
acaacatttttgcctcnnnnnnnctttcttctttcatgcct |
241 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
43139078 |
acaacatttttgcctctttttttctttcttctttcatgcct |
43139118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 125
Target Start/End: Original strand, 46060502 - 46060566
Alignment:
| Q |
61 |
aaactctcaaatgatagtttgttgtccatttagatctcacaaaacttgaggtattagtctttaca |
125 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| | ||||| || ||||| | ||||||||| |||| |
|
|
| T |
46060502 |
aaactctcaaaggatagtttgctgtccatttgggtctcataagacttgtgatattagtctctaca |
46060566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University