View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12579_low_17 (Length: 409)

Name: NF12579_low_17
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12579_low_17
NF12579_low_17
[»] chr7 (2 HSPs)
chr7 (151-393)||(45468080-45468322)
chr7 (1-86)||(45467930-45468015)


Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 151 - 393
Target Start/End: Original strand, 45468080 - 45468322
Alignment:
151 tcagagtactggggtgatggtgattactaggcctaaaggtgggaataggagtttgtgtatggatttggaagaagttaaagcttgtagagatcttggattt 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45468080 tcagagtactggggtgatggtgattactaggcctaaaggtgggaataggagtttgtgtatggatttggaagaagttaaagcttgtagagatcttggattt 45468179  T
251 gagttggaacatgaaagaatttctgctgtttctttctctaattcaacacttgatactagcagtggtggtaattcacctattgctaattggcgaatctccg 350  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45468180 gagttggaacatgaaagaatttctgctgtttctttctctaattcaacacttgatactagcagtggtggtaattcacctattgctaattggcgaatctccg 45468279  T
351 gtcccggtaggtgtcaattaggtcgatttattcgagtttattt 393  Q
    |||||||||||| ||||||||||||||||||||||||||||||    
45468280 gtcccggtaggtctcaattaggtcgatttattcgagtttattt 45468322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 45467930 - 45468015
Alignment:
1 tttgggaggtaggagaaggaggaggagaaggagaatgagaagtggtgtgtttgaaaggggaaatagttgggagaatttatgggatc 86  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45467930 tttgggaggtaggagaaggaggaggagaaggagaatgagaagtggtgtgtttgaaaggggaaatagttgggagaatttatgggatc 45468015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University