View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_17 (Length: 409)
Name: NF12579_low_17
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 151 - 393
Target Start/End: Original strand, 45468080 - 45468322
Alignment:
| Q |
151 |
tcagagtactggggtgatggtgattactaggcctaaaggtgggaataggagtttgtgtatggatttggaagaagttaaagcttgtagagatcttggattt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468080 |
tcagagtactggggtgatggtgattactaggcctaaaggtgggaataggagtttgtgtatggatttggaagaagttaaagcttgtagagatcttggattt |
45468179 |
T |
|
| Q |
251 |
gagttggaacatgaaagaatttctgctgtttctttctctaattcaacacttgatactagcagtggtggtaattcacctattgctaattggcgaatctccg |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468180 |
gagttggaacatgaaagaatttctgctgtttctttctctaattcaacacttgatactagcagtggtggtaattcacctattgctaattggcgaatctccg |
45468279 |
T |
|
| Q |
351 |
gtcccggtaggtgtcaattaggtcgatttattcgagtttattt |
393 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45468280 |
gtcccggtaggtctcaattaggtcgatttattcgagtttattt |
45468322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 45467930 - 45468015
Alignment:
| Q |
1 |
tttgggaggtaggagaaggaggaggagaaggagaatgagaagtggtgtgtttgaaaggggaaatagttgggagaatttatgggatc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45467930 |
tttgggaggtaggagaaggaggaggagaaggagaatgagaagtggtgtgtttgaaaggggaaatagttgggagaatttatgggatc |
45468015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University