View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_23 (Length: 378)
Name: NF12579_low_23
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 3e-61; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 42169681 - 42169539
Alignment:
| Q |
20 |
actatgacctctccctcgaccgtgtctaattcctcgacttgattcgattccctcgtattgttggaaaatccaaaactgactcctttacattttcttgtgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
42169681 |
actatgacctctccctcgaccgtgtctaattcctcgacttgattc-----cctcgtattgttggaaattccaaaactgactcctttacattttcttatgt |
42169587 |
T |
|
| Q |
120 |
cgtatgagaacctagcttcttccgttttcttatgccaaagctcttagc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169586 |
cgtatgagaacctagcttcttccgttttcttatgccaaagctcttagc |
42169539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 232 - 322
Target Start/End: Complemental strand, 42169414 - 42169324
Alignment:
| Q |
232 |
agctttattggatgatgcatgctttaaacattgggnnnnnnnctttatgcatattttaaatgaattccttttgtttttattgaagcttcaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42169414 |
agctttattggatgatgcatgctttaaacattggatttttttctttatgcatattttaaatgaattccttttgtttttattgaagcttcaa |
42169324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 42169515 - 42169471
Alignment:
| Q |
191 |
gcctttagaatgatcccaagtgtcttatttatagtgttttcagct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42169515 |
gcctttagaatgatcccaagtgtcttatttatagttttttcagct |
42169471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 369
Target Start/End: Complemental strand, 42169311 - 42169283
Alignment:
| Q |
341 |
atttctccatatatgtagatgtttcatct |
369 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42169311 |
atttctccatatatgtagatgtttcatct |
42169283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 232 - 322
Target Start/End: Complemental strand, 36075439 - 36075347
Alignment:
| Q |
232 |
agctttattggatgatgcatgctttaaacattgggnnnnnnncttt--atgcatattttaaatgaattccttttgtttttattgaagcttcaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36075439 |
agctttattggatgatgcatgctttaaacattggatttttttttttttatacatattttaaatgaattcgttttgtttttattgaagcttcaa |
36075347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University