View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_24 (Length: 375)
Name: NF12579_low_24
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 19 - 366
Target Start/End: Complemental strand, 137760 - 137413
Alignment:
| Q |
19 |
tcatccggcaacctacgggagggacaatataactgtcggttttatacaggctataaggaacaatggatccctttgtccatataattcagatatgacttcc |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137760 |
tcatccagcaacctacgggagggacaatataactgtcggttttatacaggctataaggaacaatggatccctttgtccatataattcagatatgacttcc |
137661 |
T |
|
| Q |
119 |
atttgttacctctttgctcgcaagtttgatcccagtgcattggagcccttgcttgacctctcttccgaagtcatgaacttttaattttttctattcatgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137660 |
atttgttacctctttgctcgcaagtttgatcccagtgcattggagcccttgcttgacctctcttccgaagtcatgaacttttaattttttctattcatgt |
137561 |
T |
|
| Q |
219 |
atgtacaagaggtcagatgtttaactcattcttttagtcttagtccctagattttggtagaggatttcacaacttcagtaagtaagaaatcatttcgcat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137560 |
atgtacaagaggtcagatgtttaactcattcttttagtcttagtccctagattttggtagaggatttcacaacttcagtaagtaagaaatcatttcgcat |
137461 |
T |
|
| Q |
319 |
tggtagatctgtctgtacaggtattgttagagaatttgggttctctgc |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137460 |
tggtagatctgtctgtacaggtattgttagagaatttgggttctctgc |
137413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University