View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_25 (Length: 374)
Name: NF12579_low_25
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 258
Target Start/End: Complemental strand, 38620073 - 38619818
Alignment:
| Q |
15 |
ttcactggcgtagtagctttcttcacagccggttttgccgcagcagctctcttcccaggtgatgtccttgttgaagttcttgaagccttagcaggcctcg |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620073 |
ttcactggcgtagcagctttcttcacagccggttttgccgcagcagctctcttcccaggtgatgtccttgttgaagttcttgaagccttagcaggcctcg |
38619974 |
T |
|
| Q |
115 |
cagctggtttcgccttggcagctggcttagccttagccgcgggctttgccttagcagtcacaggtacagcattggccttagcaacaggagccttcg---- |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619973 |
cagctggtttcgccttggcagctggcttagccttagccgcgggctttgccttagcagccacaggtacagcattggccttagcaacaggagccttcgcctt |
38619874 |
T |
|
| Q |
211 |
--------ccttcgccacaggcttagccttggcagcaggctttgccttcacagcag |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38619873 |
gggcttcgccttcgccacaggcttagccttggcagcaggctttgccttcgcagcag |
38619818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 324 - 355
Target Start/End: Complemental strand, 38619746 - 38619715
Alignment:
| Q |
324 |
ggagcagctttcgccttagacttagcagctgg |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38619746 |
ggagcagctttcgccttagacttagcagctgg |
38619715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University