View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_30 (Length: 329)
Name: NF12579_low_30
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 13 - 311
Target Start/End: Complemental strand, 42033930 - 42033632
Alignment:
| Q |
13 |
gttcactgttcatttttgttgttgttgtatgtctcagatagactttgtaatgggaagctgggtgcatgctgagctaccaacaggaggatcattagatata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033930 |
gttcactgttcatttttgttgttgttgtatgtctcagatagactttgtaatgggaagctgggtgcatgctgagctaccaacaggaggatcattagatata |
42033831 |
T |
|
| Q |
113 |
acatctctttcagcctatcttaacagttcaaatgatgcaccaaatttcgtgttcgagctgatccgaagcagtccaacaatgctaattcttgttcttgatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033830 |
acatctctttcagcctatcttaacagttcaaatgatgcaccaaatttcgtgttcgagctgatccgaagcagtccaacaatgctaattcttgttcttgatt |
42033731 |
T |
|
| Q |
213 |
taccacctcgaaaagaccttgttctttggccagattaccttaaaactttctatgaggacactaaactggatacacataaacaggctttggaaaaaattc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033730 |
taccacctcgaaaagaccttgttctttggccagattaccttaaaactttctatgaggacactaaactggatacacataaacaggctttggaaaaaattc |
42033632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University