View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_49 (Length: 248)
Name: NF12579_low_49
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_49 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 11412874 - 11413106
Alignment:
| Q |
16 |
cacaattttggtacgttctttcatcgattttgtggagcagaggtagttgacaaaggctatgatgcttgaattgataataacgtgggtaatgcttgaaaac |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11412874 |
cacaattttggtatgttctttcatcgattttgtggagcagaggtagatgacaaaggctatgatgcttgaattgataaaaacgtgggtaatgcttgaaaac |
11412973 |
T |
 |
| Q |
116 |
tccataaaataaaatgacccatttttcgattttgctcctctgatacaaaaactactaactgtgacataatatgatttttattccatgtgactgatgataa |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11412974 |
tccataaaacaaaatgacccatttttcgattttgttcctctgatacaaaaactactaactctgacataatatgatttttattccatgtgactgatgataa |
11413073 |
T |
 |
| Q |
216 |
gtggaaaaactatctaatgaattttatcaagaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
11413074 |
gtggaaaaactatctaatgaattttaccaagaa |
11413106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University