View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_54 (Length: 238)
Name: NF12579_low_54
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 36060505 - 36060300
Alignment:
| Q |
18 |
tagcaattcagggatttgaattattttatttctttggaaaagggattttgattttgagcagtcaaaattctgtaattacactagttccttcattagtgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36060505 |
tagcaattcagggatttgaattattttatttctttggaaaagggattttgattttgagcagtcaaaattctgtaattacactagttcctttattagtgga |
36060406 |
T |
|
| Q |
118 |
tattcgatcaaaattggacgatttagatttcaatatagatttcaatattttgaagatg-nnnnnnntccaaaatacaaatttgagatccacagcccaaac |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
36060405 |
tattcgatcaaaattggacgatttaaatttcaatatagattttgatattttgaagatgaaaaaaaatccaaaatacaaatttgaaatccacagcccaaac |
36060306 |
T |
|
| Q |
217 |
atgcca |
222 |
Q |
| |
|
|||||| |
|
|
| T |
36060305 |
atgcca |
36060300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University