View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12579_low_59 (Length: 233)
Name: NF12579_low_59
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12579_low_59 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 101 - 233
Target Start/End: Complemental strand, 27034415 - 27034299
Alignment:
| Q |
101 |
gctcaaacagattttggacctacatgtataaacatggacgaggttctcatttctcaagcaattaagtccttctcaatgaatgtactatttgtttgacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
27034415 |
gctcaaacagattttggacctacatgtataaacatggacgaggttctcatttctcaag---------------caatgaatgtacta-ttgtttgacata |
27034332 |
T |
|
| Q |
201 |
aataaatgcacttgttgtcgggtccacagcttg |
233 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
27034331 |
aataaatacacttgttgtcgggtccacagcttg |
27034299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 11 - 63
Target Start/End: Complemental strand, 27034460 - 27034408
Alignment:
| Q |
11 |
gacatcatatacactgtttttctcctacttatgtgatttttatttgctcaaac |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034460 |
gacatcatatacactgtttttctcctacttatgtgatttttatttgctcaaac |
27034408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University