View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1257_low_17 (Length: 304)
Name: NF1257_low_17
Description: NF1257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1257_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 54 - 240
Target Start/End: Original strand, 7089847 - 7090033
Alignment:
| Q |
54 |
gggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccataatctacaaactgaggcacgagctacaagtgcgcggc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
7089847 |
gggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccataatctacaaactgaggcacaagctacaagtgcacggc |
7089946 |
T |
 |
| Q |
154 |
gagatggccaagaggtttcactagcttccaccctttgaattatgtctaatagtaactcgggaggtaaattagcccattgactctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7089947 |
gagatggccaagaggtttcactagcttccaccctttgaattatgtctaatagtaactcgggaggtaaattagcccattgactctgtg |
7090033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 54 - 238
Target Start/End: Original strand, 7669673 - 7669857
Alignment:
| Q |
54 |
gggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccataatctacaaactgaggcacgagctacaagtgcgcggc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7669673 |
gggaaagtgatccaaccacactgttcaagtgtcttcacaacaccctttgttatgtctctccacaatctacaaactgaggcacaagctacaagtgcgcgga |
7669772 |
T |
 |
| Q |
154 |
gagatggccaagaggtttcactagcttccaccctttgaattatgtctaatagtaactcgggaggtaaattagcccattgactctg |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
7669773 |
gagatggccaagtggtttcactagcttccaccctttgaattatgtctaatagtaactcaggaggtaagttagcccattgactctg |
7669857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University