View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1257_low_20 (Length: 267)
Name: NF1257_low_20
Description: NF1257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1257_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 222
Target Start/End: Complemental strand, 34975901 - 34975708
Alignment:
| Q |
29 |
taggcctattgacttcatgatggaaagtaagttagaaggcataattgggagtagttctaggaattttgataattattttggaaatagtgatcatatgaat |
128 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975901 |
taggcctattgacttcatgatggaaaataagttagaaggcataattgggagtagttctaggaattttgataattattttggaaatagtgatcatatgaat |
34975802 |
T |
|
| Q |
129 |
atgaatatgggtgttgggattggaggagatatgatgaatggacaaaatgggttgccacagaattttcatcatgcatttggtggaatgtcatttg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975801 |
atgaatatgggtgttgggattggaggagatatgatgaatggacaaaatgggttgccacagaattttcatcatgcatttggtggaatgtcatttg |
34975708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University