View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1257_low_41 (Length: 202)
Name: NF1257_low_41
Description: NF1257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1257_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 8002638 - 8002520
Alignment:
| Q |
1 |
tgataaaggtgtaaagctaatgcaggtcgataccaactcctataaatcacgttttataaattctactaattatgtttctttattaggtttatgatttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8002638 |
tgataaaggtgtaaagctaatgcaggtcgataccaactcctataaatcacgttttataaattctactaattatgtttctttattaggtttatgatttgaa |
8002539 |
T |
 |
| Q |
101 |
aatatgtctgatattcttg |
119 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
8002538 |
aatatttctgatattcttg |
8002520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 49774566 - 49774688
Alignment:
| Q |
1 |
tgataaaggtgtaaagctaatgcaggtcgataccaactcctataaatc----acgttttataaattctactaattatgtttctttattaggtttatgatt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49774566 |
tgataaaggtgtaaagctaatgcaggtcgataccaactcctataaatcttaaacgttttataaattctactggttatgtttctttattaggtttatgatt |
49774665 |
T |
 |
| Q |
97 |
tgaaaatatgtctgatattcttg |
119 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49774666 |
tgaaaatatgtctgatattcttg |
49774688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University