View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1258-Insertion-1 (Length: 200)
Name: NF1258-Insertion-1
Description: NF1258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1258-Insertion-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 9e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 8 - 199
Target Start/End: Complemental strand, 13484202 - 13484011
Alignment:
| Q |
8 |
ttctgtacatgagatgacacactgttgcaatgagatatcgatattaatcggtgccaaaatagcacgtatgaatcaagggctcattctccaacactataaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13484202 |
ttctgtacatgagatgacacactgttgcaatgagatatcgatattaatcggtgccaaaatagcacgtatgaatcaagggctcattctccaacactataaa |
13484103 |
T |
|
| Q |
108 |
gctagtataaattaaatttgcannnnnnnnnnnnnnnnngcttcaaaaaacgaaccctaagctttatatttatagatgccatacatatactg |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13484102 |
actagtataaattaaatttgcatttttctttttctttttgcttcaaaaaacgaaccctaagctttatatttatagatgccatacatatactg |
13484011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University