View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12580_high_31 (Length: 217)
Name: NF12580_high_31
Description: NF12580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12580_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 17185509 - 17185415
Alignment:
| Q |
19 |
acaacgttgttgctactctttcttcttgtcacaacaaaccctatgatgatcatgctcacaccaacaacaaacgaaaacgtgatcatgctcctctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17185509 |
acaacgttgttgctactctttcttcttgtaacaacaaaccctatgatgatcatgctcacaccaacaacaaacgaaaacgtgatcatgcttctctt |
17185415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 17194937 - 17195031
Alignment:
| Q |
19 |
acaacgttgttgctactctttcttcttgtcacaacaaaccctatgatgatcatgctcacaccaacaacaaacgaaaacgtgatcatgctcctctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17194937 |
acaacgttgttgctactctttcttcttgtaacaacaaaccctatgatgatcatgctcacaccaacaacaaacgaaaacgtgatcatgcttctctt |
17195031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 143 - 205
Target Start/End: Complemental strand, 17185391 - 17185329
Alignment:
| Q |
143 |
caataattcaaggaaactcactttcaacccttatcaacatgataccaacgatgtttgtctctg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17185391 |
caataattcaaggaaactcactttcaacccttatcaacatgataccaacgatgtttgtctctg |
17185329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 143 - 205
Target Start/End: Original strand, 17195055 - 17195117
Alignment:
| Q |
143 |
caataattcaaggaaactcactttcaacccttatcaacatgataccaacgatgtttgtctctg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17195055 |
caataattcaaggaaactcactttcaacccttatcaacatgatactaacgatgtttgtctctg |
17195117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University