View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12580_high_35 (Length: 204)
Name: NF12580_high_35
Description: NF12580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12580_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 40072799 - 40072962
Alignment:
| Q |
19 |
gaagtatatcgaaaagggtagtggcaacgttgttgttgaggaggtgatagcattaggagaaagtgcagattacgatctcattgttgttgggaagggtcgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40072799 |
gaagtatatcgaaaagggtagtggcaacgttg---ttgaggaggtgatagcattaggagaaagtgcggattacgatctcattgttgttgggaagggtcgg |
40072895 |
T |
 |
| Q |
119 |
tttccgtcgactatggtggcagaactagcagagaggaaagcagagcatgcagagttaggtcccatag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40072896 |
tttccgtcgactatggtggcagaactagcagagagggaagcagagcatgcagagttaggtcccatag |
40072962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 40032134 - 40032297
Alignment:
| Q |
19 |
gaagtatatcgaaaagggtagtggcaacgttgttgttgaggaggtgatagcattaggagaaagtgcagattacgatctcattgttgttgggaagggtcgg |
118 |
Q |
| |
|
|||||||||||| |||||| ||| |||| |||| | ||||||||||| ||||||| |||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
40032134 |
gaagtatatcgagaagggtggtgccaacattgtgg---aggaggtgataacattaggggaaaacacagattacgatctcatagttgttgggaagggtcgg |
40032230 |
T |
 |
| Q |
119 |
tttccgtcgactatggtggcagaactagcagagaggaaagcagagcatgcagagttaggtcccatag |
185 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
40032231 |
tttccgtcgattatggtggcagaattagcagagaggagagctgaacatgcagagttaggtcccatag |
40032297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University