View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12580_low_37 (Length: 290)
Name: NF12580_low_37
Description: NF12580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12580_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 283
Target Start/End: Complemental strand, 37035993 - 37035721
Alignment:
| Q |
11 |
cagagatagaacttggctttgcttccagaactgcgcttctagctttgaaagagaaacgaatttccactttgattccagccctggtacgaagtccttcctc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
37035993 |
cagagatagaacttggctttgcttccagaagtgtgcttctagctttgaaagagaaacgaatttccactttgattccagccttggtacgaagtcattcctc |
37035894 |
T |
|
| Q |
111 |
ctgttcgacgattcactcttccaggccttgcttgcctcgtgcgagaaaagagggaaagtgctaacatgctaacaccggtaatgggtgttgccgcatctga |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37035893 |
ctgttcgacgattcactctttcaggccttgcttgcctcgtgcgagaaaagagagaaagtgataacatgctaacactagtaatgggtgttgccgcatctga |
37035794 |
T |
|
| Q |
211 |
gaccggaaaagctgctatttgtccaattctgccttctctctttcctgtatacttctagtactattgatgatgt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
37035793 |
gaccggaaaagctgctatttgtccaattctgccttctctctttcctgcatacttctagtactattgattatgt |
37035721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 285
Target Start/End: Original strand, 21309498 - 21309554
Alignment:
| Q |
229 |
ttgtccaattctgccttctctctttcctgtatacttctagtactattgatgatgtcc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21309498 |
ttgtccaattctgccttctctctttcctgtatacttctagtactattgatcatgtcc |
21309554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University