View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12580_low_52 (Length: 226)
Name: NF12580_low_52
Description: NF12580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12580_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 42 - 192
Target Start/End: Original strand, 31570713 - 31570863
Alignment:
| Q |
42 |
ataatcgatttatttcattacatatatatttactttttggtacactagaaatccagcaatttgatactgaaatttcacttctagcaatgctatatagcaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31570713 |
ataatcgatttatttcattacatatatatttactttttggtacactagaaatccagcacattgatactgaaatttcacttctagcaatgctatatagcaa |
31570812 |
T |
|
| Q |
142 |
ttgctaatggtttggagttcatcaccataaagatggaaactaaaccatgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31570813 |
ttgctaatggtttggagttcatcaccataaagatggaaactaaaccatgtt |
31570863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University